99
|
TaKaRa
prime star hs dna polymerase Prime Star Hs Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prime star hs dna polymerase/product/TaKaRa Average 99 stars, based on 1 article reviews
prime star hs dna polymerase - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
human akt2 sirna Human Akt2 Sirna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human akt2 sirna/product/GenScript corporation Average 90 stars, based on 1 article reviews
human akt2 sirna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
β2m reverse primer β2m Reverse Primer, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/β2m reverse primer/product/GenScript corporation Average 90 stars, based on 1 article reviews
β2m reverse primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
primer sequences Primer Sequences, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer sequences/product/Microsynth ag Average 90 stars, based on 1 article reviews
primer sequences - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gapdh sirna Gapdh Sirna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gapdh sirna/product/GenScript corporation Average 90 stars, based on 1 article reviews
gapdh sirna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) Gapdh (Forward Primer: 5′–Aatcccatcaccatcttcca–3′; Reverse Primer: 5′–Tggactccacgacgtactca–3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)/product/GenScript corporation Average 90 stars, based on 1 article reviews
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
superscript ii Superscript Ii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/superscript ii/product/Thermo Fisher Average 90 stars, based on 1 article reviews
superscript ii - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
92
|
Addgene inc
human forward accatggggagcagcaagagc myr haakt2 pbabe purol myr ha akt2 Human Forward Accatggggagcagcaagagc Myr Haakt2 Pbabe Purol Myr Ha Akt2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human forward accatggggagcagcaagagc myr haakt2 pbabe purol myr ha akt2/product/Addgene inc Average 92 stars, based on 1 article reviews
human forward accatggggagcagcaagagc myr haakt2 pbabe purol myr ha akt2 - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
90
|
Agilent technologies
pef6/v5-his topo construct wt myr-akt2 Pef6/V5 His Topo Construct Wt Myr Akt2, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pef6/v5-his topo construct wt myr-akt2/product/Agilent technologies Average 90 stars, based on 1 article reviews
pef6/v5-his topo construct wt myr-akt2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
pkc Pkc, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pkc/product/Becton Dickinson Average 90 stars, based on 1 article reviews
pkc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Agilent technologies
sdm kit Sdm Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sdm kit/product/Agilent technologies Average 90 stars, based on 1 article reviews
sdm kit - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Signalway Antibody
phospho-akt2 ser474 antibody Phospho Akt2 Ser474 Antibody, supplied by Signalway Antibody, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phospho-akt2 ser474 antibody/product/Signalway Antibody Average 90 stars, based on 1 article reviews
phospho-akt2 ser474 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |