akt2 forward primer Search Results


99
TaKaRa prime star hs dna polymerase
Prime Star Hs Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prime star hs dna polymerase/product/TaKaRa
Average 99 stars, based on 1 article reviews
prime star hs dna polymerase - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

90
GenScript corporation human akt2 sirna
Human Akt2 Sirna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human akt2 sirna/product/GenScript corporation
Average 90 stars, based on 1 article reviews
human akt2 sirna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation β2m reverse primer
β2m Reverse Primer, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/β2m reverse primer/product/GenScript corporation
Average 90 stars, based on 1 article reviews
β2m reverse primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Microsynth ag primer sequences
Primer Sequences, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/Microsynth ag
Average 90 stars, based on 1 article reviews
primer sequences - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation gapdh sirna
Gapdh Sirna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gapdh sirna/product/GenScript corporation
Average 90 stars, based on 1 article reviews
gapdh sirna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)
Gapdh (Forward Primer: 5′–Aatcccatcaccatcttcca–3′; Reverse Primer: 5′–Tggactccacgacgtactca–3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher superscript ii
Superscript Ii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/superscript ii/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
superscript ii - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

92
Addgene inc human forward accatggggagcagcaagagc myr haakt2 pbabe purol myr ha akt2
Human Forward Accatggggagcagcaagagc Myr Haakt2 Pbabe Purol Myr Ha Akt2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human forward accatggggagcagcaagagc myr haakt2 pbabe purol myr ha akt2/product/Addgene inc
Average 92 stars, based on 1 article reviews
human forward accatggggagcagcaagagc myr haakt2 pbabe purol myr ha akt2 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
Agilent technologies pef6/v5-his topo construct wt myr-akt2
Pef6/V5 His Topo Construct Wt Myr Akt2, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pef6/v5-his topo construct wt myr-akt2/product/Agilent technologies
Average 90 stars, based on 1 article reviews
pef6/v5-his topo construct wt myr-akt2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Becton Dickinson pkc
Pkc, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pkc/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
pkc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Agilent technologies sdm kit
Sdm Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sdm kit/product/Agilent technologies
Average 90 stars, based on 1 article reviews
sdm kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Signalway Antibody phospho-akt2 ser474 antibody
Phospho Akt2 Ser474 Antibody, supplied by Signalway Antibody, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phospho-akt2 ser474 antibody/product/Signalway Antibody
Average 90 stars, based on 1 article reviews
phospho-akt2 ser474 antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results